Cellular transfection using rapid decrease in hydrostatic pressure.

Of all methods exercised in modern molecular biology, modification of cellular properties through the introduction or removal of nucleic acids is one of the most fundamental. As such, several methods have arisen to promote this process; these include the condensation of nucleic acids with calcium, polyethylenimine or modified lipids, electroporation, viral production, biolistics, and microinjection. An ideal transfection method would be (1) low cost, (2) exhibit high levels of biological safety, (3) offer improved efficacy over existing methods, (4) lack requirements for ongoing consumables, (5) work efficiently at any scale, (6) work efficiently on cells that are difficult to transfect by other methods, and (7) be capable of utilizing the widest array of existing genetic resources to facilitate its utility in research, biotechnical and clinical settings. To address such issues, we describe here Pressure-jump-poration (PJP), a method using rapid depressurization to transfect even difficult to modify primary cell types such as embryonic stem cells. The results demonstrate that PJP can be used to introduce an array of genetic modifiers in a safe, sterile manner. Finally, PJP-induced transfection in primary versus transformed cells reveals a surprising dichotomy between these classes which may provide further insight into the process of cellular transformation.

Microfluidics-based PLGA nanoparticles of ratiometric multidrug: From encapsulation and release rates to cytotoxicity in human lens epithelial cells.

Multidrug nanomedicine is an effective therapeutic approach for the treatment of chronic diseases and cancers. However, co-encapsulation and release of drug combination at a fixed ratio by nanoparticles, particularly for long acting ocular formulations, remains challenging. Herein, poly (lactic-co-glycolic acid) nanoparticles ratiometrically co-encapsulating hydrophilic dual drugs, mitomycin C and doxorubicin, was obtained (D/M PLGANPs) by combining microfluidics and the Design of Experiments approaches. The formulation variable of lactide-to-glycolide ratios (L/G 50:50, 75:15 and 85:15) was used to achieve fast, medium and slow drug release rates of D/M PLGANPs. The dissolution of D/M PLGANPs in simulated intraocular fluid exhibited sustained release of dual drugs at the fixed ratio over 7 days, and analysis using the Korsmeyer-Peppas model showed mechanism of drug release to be governed by diffusion. More importantly, in human lens epithelial cells, the drug release rate was negatively correlated with drug potency. The slower drug release from D/M PLGANPs led to lower efficacy of drug combination against pathogenesis of cellular migration and proliferation, the key pathogenic processes of capsular opacification after cataract surgery. Compared to fast (L/G 50:50) and medium (L/G 75:15) drug release rate of D/M PLGANPs, the slow release formulation (L/G 85:15) exhibited the least cellular uptake of the dual drugs and the ratio of drug combination was not maintained intracellularly. The present study implicates the potential of using microfluidics for synthesizing polymeric nanoparticles of ratiometric drug combination and highlights the drug release rate as the critical determinant of efficacy for the long-acting nanomedicine design.

Enhancement of the thermal stability of G-quadruplex structures by urea.

The solute urea has been used extensively as a denaturant in protein folding studies; double-stranded nucleic acid structures are also destabilized by urea, but comparatively less than proteins. In previous research, the solute has been shown to strongly destabilize folded G-quadruplex DNA structures. This contribution demonstrates the stabilizing effect of urea on the G-quadruplex formed by the oligodeoxyribonucleotide (ODN), G3T (d[5'-GGGTGGGTGGGTGGG-3']), and related sequences in the presence of sodium or potassium cations. Stabilization is observed up to 7 M urea, which was the highest concentration we investigated. The folded structure of G3T has three G-tetrads and three loops that consist of single thymine residues. ODNs related to G3T, in which the thymine residues in the loop are substituted by adenosine residues, also exhibit enhanced stability in the presence of molar concentrations of urea. The circular dichroism (CD) spectra of these ODNs in the presence of urea are consistent with that of a G-quadruplex. As the urea concentration increases, the spectral intensities of the peaks and troughs change, while their positions change very little. The heat-induced transition from the folded to unfolded state, Tm, was measured by monitoring the change in the UV absorption as a function of temperature. G-quadruplex structures with loops containing single bases exhibited large increases in Tm with increasing urea concentrations. These data imply that the loop region play a significant role in the thermal stability of tetra-helical DNA structures in the presence of the solute urea.

Clinical Translation of Long-Acting Drug Delivery Systems for Posterior Capsule Opacification Prophylaxis.

Posterior capsule opacification (PCO) remains the most common cause of vision loss post cataract surgery. The clinical management of PCO formation is limited to either physical impedance of residual lens epithelial cells (LECs) by implantation of specially designed intraocular lenses (IOL) or laser ablation of the opaque posterior capsular tissues; however, these strategies cannot fully eradicate PCO and are associated with other ocular complications. In this review, we critically appraise recent advances in conventional and nanotechnology-based drug delivery approaches to PCO prophylaxis. We focus on long-acting dosage forms, including drug-eluting IOL, injectable hydrogels, nanoparticles and implants, highlighting analysis of their controlled drug-release properties (e.g., release duration, maximum drug release, drug-release half-life). The rational design of drug delivery systems by considering the intraocular environment, issues of initial burst release, drug loading content, delivery of drug combination and long-term ocular safety holds promise for the development of safe and effective pharmacological applications in anti-PCO therapies.

Interaction of an anticancer benzopyrane derivative with DNA: Biophysical, biochemical, and molecular modeling studies.

BACKGROUND: SIMR1281 is a potent anticancer lead candidate with multi- target activity against several proteins; however, its mechanism of action at the molecular level is not fully understood. Revealing the mechanism and the origin of multitarget activity is important for the rational identification and optimization of multitarget drugs. METHODS: We have used a variety of biophysical (circular dichroism, isothermal titration calorimetry, viscosity, and UV DNA melting), biochemical (topoisomerase I & II assays) and computational (molecular docking and MD simulations) methods to study the interaction of SIMR1281 with duplex DNA structures. RESULTS: The biophysical results revealed that SIMR1281 binds to dsDNA via an intercalation-binding mode with an average binding constant of 3.1 × 106 M-1. This binding mode was confirmed by the topoisomerases' inhibition assays and molecular modeling simulations, which showed the intercalation of the benzopyrane moiety between DNA base pairs, while the remaining moieties (thiazole and phenyl rings) sit in the minor groove and interact with the flanking base pairs adjacent to the intercalation site. CONCLUSIONS: The DNA binding characteristics of SIMR1281, which can disrupt/inhibit DNA function as confirmed by the topoisomerases' inhibition assays, indicate that the observed multi-target activity might originate from ligand intervention at nucleic acids level rather than due to direct interactions with multiple biological targets at the protein level. GENERAL SIGNIFICANCE: The findings of this study could be helpful to guide future optimization of benzopyrane-based ligands for therapeutic purposes.

Blood-declustering excretable metal clusters assembled in DNA matrix.

We report polymeric DNA-supported gold clusters that achieve interparticle plasmon-coupling, generate immunotherapeutic effects at the tumor tissue, but decluster in the bloodstream. As immunostimulating DNA, we used polyCpG DNA, which could act as a supporting matrix for metal clusters, enabling the clusters to decluster in the bloodstream. We constructed polyCpG-supported gold nanoclusters (AuPCN). For comparison with AuPCN, monomer CpG-bound gold nanoparticles (AuMC) were used. Unlike AuMC, AuPCN showed an interparticle plasmon-coupling effect and a higher light-to heat conversion efficiency. In the serum, AuPCN declustered to subunits. The CT26 tumor rechallenge of mice pretreated with AuPCN(+NIR) was followed by 0% tumor recurrence and 100% survival for up to 80 days. Compared with other groups, AuPCN(+NIR)-treated mice revealed greater cytotoxic T cell-infiltration in distant tumors and higher memory T cells in the lymph nodes. Until 7 days post-dose, the urinary excretion of Au was observed in the AuPCN-treated group, but not in the Au nanoparticle-treated mice. Although we used gold clusters and concatemeric immunostimulatory CpG as components of AuPCN, the concept of declustering in the bloodstream can be applied to design other functional DNA scaffold-based metal clusters with reduced concerns for long-term retention in the body.

The Pressure Dependence of the Stability of the G-quadruplex Formed by d(TGGGGT).

The G-quadruplex (GQ), a tetrahelix formed by guanine-rich nucleic acid sequences, is a potential drug target for several diseases. Monomolecular GQs are stabilized by guanine tetrads and non-guanine regions that form loops. Hydrostatic pressure destabilizes the folded, monomolecular GQ structures. In this communication, we present data on the effect of pressure on the conformational stability of the tetramolecular GQ, d[5'-TGGGGT-3']4. This molecule does not have loops linking the tetrads; thus, its physical properties presumably reflect those of the tetrads alone. Understanding the properties of the tetrads will aid in understanding the contribution of the other structural components to the stability of GQ DNA. By measuring UV light absorption, we have studied the effect of hydrostatic pressure on the thermal stability of the tetramolecular d[5'-TGGGGT-3']4 in the presence of sodium ions. Our data show that, unlike monomolecular GQ, the temperature at which d[5'-TGGGGT-3']4 dissociates to form the constituent monomers is nearly independent of pressure up to 200 MPa. This implies that there is no net molar volume difference (∆V) between the GQ and the unfolded random-coil states. This finding further suggests that the large negative ∆V values for the unfolding of monomolecular GQ are due to the presence of the loop regions in those structures.

Dimethyl sulfoxide (DMSO) is a stabilizing co-solvent for G-quadruplex DNA.

We report the effect of dimethyl sulfoxide (DMSO) on the stability of the four-stranded structures formed by the oligodeoxyribonucleotides d[5'-AGGG(TTAGGG)3-3'] (HTel), d[5'-(GGGT)3GGG-3'] (G3T), d[5'-GGTTGGTGTGGTTGG-3] (TBA), d[5'-GGGGTTTTGGGG-3'] (Oxy-1.5), and d[5'-TGGGGT-3'] (TG4T). In these measurements, influence of the co-solvent was assessed by the change in the mid-point of the heat-induced unfolding, Tm, by monitoring the change in the UV absorption of the sample. Increasing concentrations of DMSO led to an increase in the Tm from the folded to unfolded states. We have also studied the effect of the denaturant urea and mixtures of urea and DMSO on the stability of the intramolecular HTel and the intermolecular TG4T G-quadruplexes. Consistent with earlier data, we found that urea destabilized the folded G-quadruplex structure; the Tm decreases with increasing urea concentration. However, in solutions containing both urea and DMSO, we observed that the two co-solvents off-set the destabilizing and stabilizing effect, respectively, of one another. That is, in solutions containing urea, increasing concentrations of DMSO led to the increase of the Tm of the G-quadruplex structure. This effect is observed in solutions containing sodium, potassium, or ammonium as the ion that stabilizes the folded G-quadruplex structure. The complementary effect of the two co-solvents presumably arises from differential interactions between urea and DMSO and the oligonucleotide or the cations involved in the stabilization of the G-quadruplexes. These results highlight the importance of co-solutes and co-solvents in systems containing guanine-rich DNA, particularly experimental processes that require DMSO.

Volumetric Properties of Four-Stranded DNA Structures.

Four-stranded non-canonical DNA structures including G-quadruplexes and i-motifs have been found in the genome and are thought to be involved in regulation of biological function. These structures have been implicated in telomere biology, genomic instability, and regulation of transcription and translation events. To gain an understanding of the molecular determinants underlying the biological role of four-stranded DNA structures, their biophysical properties have been extensively studied. The limited libraries on volume, expansibility, and compressibility accumulated to date have begun to provide insights into the molecular origins of helix-to-coil and helix-to-helix conformational transitions involving four-stranded DNA structures. In this article, we review the recent progress in volumetric investigations of G-quadruplexes and i-motifs, emphasizing how such data can be used to characterize intra-and intermolecular interactions, including solvation. We describe how volumetric data can be interpreted at the molecular level to yield a better understanding of the role that solute-solvent interactions play in modulating the stability and recognition events of nucleic acids. Taken together, volumetric studies facilitate unveiling the molecular determinants of biological events involving biopolymers, including G-quadruplexes and i-motifs, by providing one more piece to the thermodynamic puzzle describing the energetics of cellular processes in vitro and, by extension, in vivo.

Volumetric Interplay between the Conformational States Adopted by Guanine-Rich DNA from the c-MYC Promoter.

The kinetic and thermodynamic stabilities of G-quadruplex structures have been extensively studied. In contrast, systematic investigations of the volumetric properties of G-quadruplexes determining their pressure stability are still relatively scarce. The G-rich strand from the promoter region of the c-MYC oncogene (G-strand) is known to adopt a range of conformational states including the duplex, G-quadruplex, and coil states depending on the presence of the complementary C-rich strand (C-strand) and solution conditions. In this work, we report changes in volume, ΔV, and adiabatic compressibility, ΔKS, accompanying interconversions of G-strand between the G-quadruplex, duplex, and coil conformations in the presence and absence of C-strand. We rationalize these volumetric characteristics in terms of the hydration and intrinsic properties of the DNA in each of the sampled conformational states. We further use our volumetric results in conjunction with the reported data on changes in expansibility, ΔE, and heat capacity, ΔCP, associated with G-quadruplex-to-coil transitions to construct the pressure-temperature phase diagram describing the stability of the G-quadruplex. The phase diagram is elliptic in shape, resembling the classical elliptic phase diagram of a globular protein, and is distinct from the phase diagram for duplex DNA. The observed similarity of the pressure-temperature phase diagrams of G-quadruplexes and globular proteins stems from their shared structural and hydration features that, in turn, result in the similarity of their volumetric properties. To the best of our knowledge, this is the first pressure-temperature stability diagram reported for a G-quadruplex.

Duplex-tetraplex equilibria in guanine- and cytosine-rich DNA.

Noncanonical four-stranded DNA structures, including G-quadruplexes and i-motifs, have been discovered in the cell and are implicated in a variety of genomic regulatory functions. The tendency of a specific guanine- and cytosine-rich region of genomic DNA to adopt a four-stranded conformation depends on its ability to overcome the constraints of duplex base-pairing by undergoing consecutive duplex-to-coil and coil-to-tetraplex transitions. The latter ability is determined by the balance between the free energies of participating ordered and disordered structures. In this review, we present an overview of the literature on the stability of G-quadruplex and i-motif structures and discuss the extent of duplex-tetraplex competition as a function of the sequence context of the DNA and environmental conditions including temperature, pH, salt, molecular crowding, and the presence of G-quadruplex-binding ligands. We outline how the results of in vitro studies can be expanded to understanding duplex-tetraplex equilibria in vivo.

Biochemical reprogramming of tumors for active modulation of receptor-mediated nanomaterial delivery.

Here we report that reactive oxygen species (ROS) can reprogram cancer cells to increase the expression of specific receptors and modulate the delivery of nanomaterials. Gold and γ-polyglutamic acid (γ-PGA) hybrid nanoparticles (PGANP) were prepared via a facile single-step process. Gold nanoclusters in PGANP were dispersed within the tangled γ-PGA matrix of the nanoparticles. The condensed assembly of gold nanoclusters in γ-PGA matrix enabled the interparticle plasmon coupling effect, which lacks in single gold nanoparticles. Compared with gold nanoparticles of the similar sizes, PGANP showed significantly higher absorbance at near infrared (NIR) wavelength and light-to-heat converting ratios, resulting in greater temperature increase upon NIR light irradiation. Pretreatment of HeLa cancer cells with methylene blue (MB) generated reactive oxygen species. The ROS reprogrammed the cancer cells to express higher cell membrane levels of gamma glutamyl transferase (GGT), which is known to bind to γ-PGA of PGANP. MB pretreatment significantly enhanced delivery of PGANP to cancer cells. Cancer cells internalized PGANP to a greater extent and, were highly susceptible to irradiation with NIR light, which reduced cell viability to near zero. In vivo, MB pretreatment of HeLa xenograft mice increased the expression of GGT in tumor tissues. In mice pretreated with MB and exposed to NIR irradiation, PGANP treatment resulted in complete tumor ablation. The strategy of actively reprogramming tumor membrane levels of target receptors could be widely applied to overcome the heterogeneity of cancer cells. Although we used interparticle plasmon coupling effect-based PGANP for proving the concept of receptor-modulated delivery, this strategy could be broadly applicable to the active modulation of the receptor-mediated delivery of anticancer nanomaterials.

Sequential activation of anticancer therapy triggered by tumor microenvironment-selective imaging.

The combination of imaging and anticancer therapy has recently emerged as a promising strategy. However, nonspecific imaging signals and distribution of anticancer drugs at normal tissues limit the specificity of the combination therapy. To overcome the challenges, we designed a system which can selectively visualize cancer tissues and initiate the subsequent action of therapeutic molecules in tumor microenvironment. Exploiting the overexpression of matrix metalloproteinase (MMP) in the tumor microenvironment, we designed a graphene oxide (GO)-based nanosheet system loaded with a pegylated MMP-cleavable imaging probe and an anticancer peptide shielded under the imaging probe. GO loaded with pegylated imaging probe derivative and anticancer buforin IIb peptide (IPGO/BF) was not fluorescent and BF hidden within pegylated surfaces did not exert anticancer activity. However, in tumor microenvironment, IPGO/BF selectively provided imaging by liberating pegylated fluorescent moiety. The cleavage of MMP-sensitive peptide triggered imaging signal and subsequent exposure of shielded BF on GO and enhanced its therapeutic function. SCC7 tumor-bearing mice treated with IPGO/BF exhibited selective fluorescence in tumor tissues, and greater imaging signal-dependent antitumor effects compared with other groups. The selective imaging-dependent sequential activation of anticancer therapy in tumor microenvironment would be a feasible strategy to reduce the nonspecific false-positive signals of tumor imaging and undesirable side effects of anticancer drugs at normal tissues.

On empirical decomposition of volumetric data.

Volumetric characterization of proteins and their recognition events has been instrumental in providing information on the role of intra- and intermolecular interactions, including hydration, in stabilizing biomolecules. The credibility of molecular models and interpretation schemes used to rationalize experimental data are essential for the validity of microscopic insights derived from volumetric results. Current empirical schemes used to interpret volumetric data suffer from a lack of theoretical and computational substantiation. In this contribution, we take advantage age of recent MD simulations of proteins in solution coupled with Voronoi-Delaunay tessellation of simulated structures that have provided an exceptional level of structural detail on the nature of protein-water interfaces. We use these structural insights to re-evaluate empirical frameworks used for interpretation of volumetric data. An important issue in this respect is the actual dividing surface between water and protein atoms that is used in volumetric studies when the solute and solvent are treated as hard spheres enclosed within their respective van der Waals surfaces. In one development, using Voronoi tessellation of MD simulated protein-water systems the dividing surface has been defined as the points equidistant from the water and protein atoms. The interstitial void volume between the solute and the dividing surface corresponds to thermal volume envisaged by Scaled Particle Theory. In this communication, we explicitly account for the contributions of thermal volume to the partial molar volume, compressibility, and expansibility of proteins and re-examine and redefine the intrinsic and hydration volumetric contributions. We discuss the implications of our results for protein transitions and association events.

Stress-induced acidification may contribute to formation of unusual structures in C9orf72-repeats.

BACKGROUND: Expansion of the C9orf72 hexanucleotide repeat (GGGGCC)n·(GGCCCC)n is the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Both strands of the C9orf72 repeat have been shown to form unusual DNA and RNA structures that are thought to be involved in mutagenesis and/or pathogenesis. We previously showed that the C-rich DNA strands from the C9orf72 repeat can form four-stranded quadruplexes at neutral pH. The cytosine residues become protonated under slightly acidic pH (pH 4.5-6.2), facilitating the formation of intercalated i-motif structures. METHODS: Using CD spectroscopy, UV melting, and gel electrophoresis, we demonstrate a pH-induced structural transition of the C-rich DNA strand of the C9orf72 repeat at pHs reported to exist in living cells under stress, including during neurodegeneration and cancer. RESULTS: We show that the repeats with lengths of 4, 6, and 8 units, form intercalated quadruplex i-motifs at low pH (pH < 5) and monomolecular hairpins and monomolecular quadruplexes under neutral-basic conditions (pH ≥ 8). Furthermore, we show that the human replication protein A (RPA) binds to the G-rich and C-rich DNA strands under acidic conditions, suggesting that it can bind to i-motif structures. CONCLUSIONS: In the proper sequence context, i-motif structures can form at pH values found in some cells in vivo. GENERAL SIGNIFICANCE: DNA conformational plasticity exists over broad range of solution conditions.

Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif.

G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN). We also conducted pH-dependent acoustic and densimetric characterizations of two DNA molecules that are compositionally identical to ODN but do not adopt the i-motif conformation, 5'-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5'-d(CACACTCCTCACCTCTCCACAC) (ODN2). Our results reveal that i-motif formation by ODN is not accompanied by changes in volume and compressibility. The volumetric similarity of the i-motif and coil states of ODN implies a fortuitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pH-dependent volumetric profiles of ODN, ODN1, and ODN2, along with the data on volumetric changes accompanying the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosines in the oligonucleotides causes release of the majority if not all of their counterions to the bulk. Thus, in the i-motif conformation, the oligomer no longer acts as a polyelectrolyte insofar as counterions are concerned. We discuss the biological ramifications of our results.

Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72.

BACKGROUND: An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures. METHODS: Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K+. RESULTS: The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules. CONCLUSIONS: For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules.

The role of loops and cation on the volume of unfolding of G-quadruplexes related to HTel.

In aqueous solutions containing sodium or potassium cations, oligodeoxyribonucleotides (ODNs) rich in guanine form four-stranded DNA structures called G-quadruplexes (G4s). These structures are destabilized by elevated hydrostatic pressure. Here, we use pressure to investigate the volumetric changes arising from the formation of G4 structures. G4s display a great deal of structural heterogeneity that depends on the stabilizing cation as well as the oligonucleotide sequence. Using UV thermal unfolding at different pressures, we have investigated the volume change of the helix-coil equilibrium of a series of ODNs whose sequences are related to the G-rich ODN HTel (d[A(GGGTTA)3GGG]), which contains four repeats of the human telomeric sequence. The experiments are conducted in aqueous buffers containing either 100mM NaCl or KCl at pH7.4. The G4s stabilized by Na+ are less sensitive to pressure perturbation than those stabilized by K+. The overall molar volume changes (ΔVtot) of the unfolding transition for all of the G4s are large and negative. A large fraction of the measured ΔVtot value arises from the re-hydration of the cations released from the interior of the folded structure. However, the differences in the measured ΔVtot values demonstrate that variations in the structure of G4s formed by each ODN, arising from differences in the sequence of the loops, contribute significantly to ΔVtot and presumably the hydration of the folded structures. Depending on the sequence of the loops, the magnitude of the measured ΔVtot can be larger or smaller than that of HTel in solutions containing sodium. However, the magnitude of ΔVtot is smaller than HTel for the unfolding of all G4s that are stabilized by potassium ions.

A Thermodynamic Study of Adenine and Thymine Substitutions in the Loops of the Oligodeoxyribonucleotide HTel.

Guanine-rich DNA oligodeoxyribonucleotides (ODN) can form four-stranded structures named quadruplexes (G4s), which are stabilized via the association of four guanine bases. Quadruplexes have a high level of conformational diversity depending on the molecularity, sequence, and the cation conditions of the G4 formation. Monomolecular G4 structures have nonguanine loops that usually consist of between one and four adenine and thymine residues. In the work reported here, we systematically modified the nucleotides in the loops of the 22 nucleotide ODN, HTel, which contains four repeats of the human telomeric sequence, GGGTTA. We studied the effect of different types of bases in the loops on the stability and topology of the G4s formed. We show that lower steric hindrance of pyrimidine residues increases the stability of G4s with a major enthalpic contribution. Stacking of the loop bases onto tetrads could compensate for the loss of rotational freedom. In addition, in the presence of sodium, the stabilities of the G4s are loop dependent. In the presence of potassium, the stability of G4 depend on the sequences of each loop. Lastly, in the presence of potassium ions, the modified HTel ODNs may exist in equilibrium of the two types of the hybrid topology, and these structures are stabilized by the second loop. Modifications of the bases in this loop change the topology and stability of the folded structures.

Concentration-dependent conformational changes in GQ-forming ODNs.

Guanine-rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes, which are four stranded structures stabilized by sodium or potassium cations. The topologies of G-quadruplexes are highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(AGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present in solution. Our previous work demonstrated that at high concentrations of H-Tel, the monomolecular G-quadruplexes formed by H-Tel self-associate to form higher order structures. The aggregates display circular dichroism (CD) spectra similar to that of an all-parallel structure. In the current work, we present data for 19 ODNs for which we have modified the loop sequences of H-Tel in order to learn if concentration-dependent self-aggregation is a general phenomenon and to probe the contribution of the loops to the self-association of these ODNs. Our studies use CD spectroscopy and spectroscopically monitored heat denaturation. Our data show that the concentration-dependent formation of parallel G-quadruplex aggregates is a general phenomenon. We propose that one of the factors that might affect this process is the association of partially unfolded antiparallel structures.